Python: How to find coordinates of short sequences in a FASTA file?

Question

I have a list of short sequences that I want to obtain its coordinate or in another word to get its bed file after compare with a fasta file which contains original sequences.

Fasta file:

>PGH2
CGTAGCGGCTGAGTGCGCGGATAGCGCGTA

Short sequence fasta file:

>PGH2
CGGCTGAGT

Is there any ways to obtain its coordinate? Bedtools can't help much.

Desired output:

PGH2  6 14

Answer 1

Using BioPyton

from Bio import SeqIO

for long_sequence_record in SeqIO.parse(open('long_sequences.fasta'), 'fasta'):
    long_sequence = str(long_sequence_record.seq)

    for short_sequence_record in SeqIO.parse(open('short_sequences.fasta'), 'fasta'):
        short_sequence = str(short_sequence_record.seq)

        if short_sequence in long_sequence:
            start = long_sequence.index(short_sequence) + 1
            stop = start + len(short_sequence) - 1
            print short_sequence_record.id, start, stop