find a DNA barcode with mismatches in sequence

Question

I have 36-nt reads like this: atcttgttcaatggccgatcXXXXgtcgacaatcaa in the fastq file with XXXX being the different barcodes. I want to search for a barcode in the file at exact position(21 to 24) and print the sequences with up to 3 mismatches in sequence not barcode.

For example: I have barcode: aacg search that barcode between position 21 to 24 in fastq file with allowing 3 mismatches in the sequence like:

atcttgttcaatggccgatcaacggtcgacaatcac # it has 1 mismatch
ttcttgttcaatggccgatcaacggtcgacaatcac # it has 2 mismatch
tccttgttcaatggccgatcaacggtcgacaatcac # it has 3 mismatch

I was trying to find unique lines first using awk and look for mismatches but it is very tedious for me to look and find them.

awk 'NR%4==2' 1.fq |sort|uniq -c|awk '{print $1"\t"$2}' > out1.txt

Is there any quick way i can find?

Thank you.

Answer 1

Using Python:

strs = "atcttgttcaatggccgatcaacggtcgacaatcaa"

with open("1.fq") as f:
    for line in f:
        if line[20:24] == "aacg":
            line = line.strip()
            mismatches = sum(x!=y for x, y  in zip(strs, line))
            if mismatches <= 3:
                print line, mismatches

atcttgttcaatggccgatcaacggtcgacaatcac 1
ttcttgttcaatggccgatcaacggtcgacaatcac 2
tccttgttcaatggccgatcaacggtcgacaatcac 3