Find the number of matching two characters in a string in Perl

Question

Is there a method in Perl (not BioPerl) to find the number of each two consecutive letters.

I.e., number of AA, AC, AG, AT, CC, CA, ... in a sequence like this:

$sequence = 'AACGTACTGACGTACTGGTTGGTACGA'

PS: We can make it manually by using the regular expression, i.e., $GC=($sequence=~s/GC/GC/g) which return the number of GC in the sequence.

I need an automated and generic way.

Answer 1

You had me confused for a while, but I take it you want to count the dinucleotides in a given string.

Code:

my @dinucs = qw(AA AC AG CC CA CG);
my %count;
my $sequence = 'AACGTACTGACGTACTGGTTGGTACGA';

for my $dinuc (@dinucs) {
    $count{$dinuc} = ($sequence =~ s/\Q$dinuc\E/$dinuc/g);
}

Output from Data::Dumper:

$VAR1 = {
          "AC" => 5,
          "CC" => "",
          "AG" => "",
          "AA" => 1,
          "CG" => 3,
          "CA" => ""
        };