I have a pandas dataframe that contains DNA sequences and gene names. I want to translate the DNA sequences into protein sequences, and store the protein sequences in a new column.
The data frame looks like:
| DNA | gene_name |
|---|---|
| ATGGATAAG | gene_1 |
| ATGCAGGAT | gene_2 |
After translating and storing the DNA, the dataframe would look like:
| DNA | gene_name | protein |
|---|---|---|
| ATGGATAAG... | gene_1 | MDK... |
| ATGCAGGAT... | gene_2 | MQD... |
I am aware of biopython's (https://biopython.org/wiki/Seq) ability to translate DNA to protein, for example:
>>> from Bio.Seq import Seq
>>> coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
>>> coding_dna.translate()
Seq('MAIVMGR*KGAR*')
However, I am not sure how to implement this in the context of a dataframe. Any help would be much appreciated!
I would suggest using pandas.DataFrame.apply.
Something like:
df['protein'] = df['DNA'].apply(lambda x: Seq(x).translate(), axis=1)