How to catch the longest sequence of a group

Question

The task is to find the longest sequence of a group

for instance, given DNA sequence: "AGATCAGATCTTTTTTCTAATGTCTAGGATATATCAGATCAGATCAGATCAGATCAGATC" and it has 7 occurrences of AGATC. (AGATC) matches all occurrences. Is it possible to write a regular expression that catches only the longest sequence, i.e. AGATCAGATCAGATCAGATCAGATC in the given text? If this is not possible only with regex, how can I iterate through each sequence (i.e. 1st sequence is AGATCAGATC, 2nd - AGATCAGATCAGATCAGATCAGATC et cetera) in python?

Answer 1

Use:

import re

sequence = "AGATCAGATCTTTTTTCTAATGTCTAGGATATATCAGATCAGATCAGATCAGATCAGATC"
matches = re.findall(r'(?:AGATC)+', sequence)

# To find the longest subsequence
longest = max(matches, key=len)

Explanation:

Non-capturing group (?:AGATC)+

• + Quantifier — Matches between one and unlimited times, as many times as possible.
• AGATC matches the characters AGATC literally (case sensitive)

Result:

# print(matches)
['AGATCAGATC', 'AGATCAGATCAGATCAGATCAGATC']

# print(longest)
'AGATCAGATCAGATCAGATCAGATC'

You can test the regex here.