I tried to run bio perl using Eclipse.
The code I tried to execute is:
use Bio::Seq;
$seq_obj = BIO::Seq->new(-seq=> "atcgatgcatgcatgcatgc", -alphabet=> 'dna');
#print $seq_obj->seq;
And I got the following error:
Can't locate object method "new" via package "BIO::Seq" (perhaps you forgot to load "BIO::Seq"?) at C:/2ndSemester/BIO424-DevelopBioinformaticTools/PerlPrograms/BIOPerlExamples/TestBIOPerl1.pl line 3.
Anybody knows why this error occured?
The class is called Bio::Seq
, not BIO::Seq
. Perl is case sensitive so you want to say:
$seq_obj = Bio::Seq->new(-seq=> "atcgatgcatgcatgcatgc", -alphabet=> 'dna');
Note the "Bio" rather than "BIO".