Can I use strcmp without pointers?

Question

I have to make a program which takes a file of DNA sequences and a DNA subsequence from command arguments and find each time the subsequence and how many times it occurs. I'm having troubles with strcmp in line 36 and 42. Currently the way I have it I figured out through GDB that I am comparing the address of the strings and not the actual strings. But if I remove the & I get an error. I'm not sure what is the correct way to go about this is. TIA

#include <stdio.h>
#include <string.h>

int main(int argc, char *argv[]) {
    // place subsequence in string
    char *subsequence = argv[2];
    // get length of subsequence
    int seqLength = strlen(subsequence);
    // define file type and open for reading
    FILE *inputFile = fopen(argv[1], "r");
    // get each line using while loop
    char inputLine[200]; // string variable to store each line
    int i, j, lineLength, counter = 0, flag = -1;

    while (fgets(inputLine, 200, inputFile) != NULL) { // loop through each line
        lineLength = strlen(inputLine);

        for (i = 0; i < lineLength; i++) { // loop through each char in the line
            if (strcmp(&inputLine[i], &subsequence[0]) == 0) { 
            // if current char matches beginning of sequence loop through
            // each of the remaining chars and check them against 
            // corresponding chars in the sequence

                flag = 0;

                for (j = i + 1; j - i < seqLength; j++) {
                    if (strcmp(&inputLine[j], &subsequence[j - i]) != 0) {
                        flag = 1;
                        break;
                    }
                }

                if (flag == 0) {
                    counter++;
                }
            }
        }
    }

    fclose(inputFile);
    printf("%s appears %d time(s)\n", subsequence, counter);
    return 0;
}

dna.txt:

GGAAGTAGCAGGCCGCATGCTTGGAGGTAAAGTTCATGGTTCCCTGGCCC

input:

./dnaSearch dna.txt GTA

expected output:

GTA appears 2 times

Answer 1

Just do like this:

if (inputLine[i] == subsequence[0]) {
    if (inputLine[j] != subsequence[j - i]) {

You do not need library functions to compare single characters.